2017-05-24 16:06:332025-05-22 04:27:18
description
multifunctional protein involved in homologous recombination and DNA repair (LexA-autocleavage), required to internalize and to recombine ssDNA with homologous resident duplex, required for efficient survival and replication restart after replication-transcription conflicts
multifunctional protein involved in homologous recombination and DNA repair ([[protein|LexA]]-autocleavage), required to internalize and to recombine ssDNA with homologous resident duplex, required for efficient survival and replication restart after replication-transcription conflicts
locus
BSU16940
BSU_16940
proteinLength
347
348
geneLength
1041
1047
product
multifunctional protein involved in homologous recombination and DNA repair (LexA-autocleavage)
multifunctional protein involved in homologous recombination and DNA repair ([[protein|LexA]]-autocleavage)
outlinks
bsu
BSU16940
BSU_16940
Gene
Coordinates
1,764,645 → 1,765,691
1,764,645 1,765,691
Gene
Phenotypes of a mutant
slower growth [Pubmed|26930481]
drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
reduced [SW|sporulation] efficiency [Pubmed|26930481]
strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
no amplification of the [[gene|gltA]]-[[gene|gltB]] chromosomal region to suppress the glutamate auxotrophy of a [[gene|gltC]] mutant [pubmed|28294562]
slower growth [Pubmed|26930481]
drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) [Pubmed|24285298]
reduced [SW|sporulation] efficiency [Pubmed|26930481]
strongly reduced chromosomal transformation rate [Pubmed|23779106,22373918]
no amplification of the [[gene|gltA]]-[[gene|gltB]] chromosomal region to suppress the glutamate auxotrophy of a [[gene|gltC]] mutant [pubmed|28294562]
sensitive to Cr(VI) treatment [pubmed|30745368]
reduced resistance towards electron beams [pubmed|31948638]
reduced viability of a [[gene|rarA]] [[gene|recA]] double mutant [pubmed|32117122]
suppression of lethality of [[gene|pcrA]] inactivation [pubmed|32793628]
The protein
Catalyzed reaction/ biological activity
RecA stimulates ssDNA phosphorylase activity of [[protein|PnpA]] [Pubmed|21859751]
RecA-ATP in concert with [[protein|DprA]] and [[protein|SsbA]] catalyzes DNA strand exchange, with [[protein|SsbB]] as an accessory factor [Pubmed|25138221]
RecA-dATP catalyzes strand exchange even in the absence of the accessory factors [Pubmed|25138221]
protects sporulating cells from DNA damage [Pubmed|26930481]
RecA stimulates ssDNA phosphorylase activity of [[protein|PnpA]] [Pubmed|21859751]
RecA-ATP in concert with [[protein|DprA]] and [[protein|SsbA]] catalyzes DNA strand exchange, with [[protein|SsbB]] as an accessory factor [Pubmed|25138221]
RecA-dATP catalyzes strand exchange even in the absence of the accessory factors [Pubmed|25138221]
protects sporulating cells from DNA damage [Pubmed|26930481]
contributes to transfection with naked phage DNA [pubmed|31876108]
[[protein|RecA]] polymerized on tailed SPP1 duplex intermediates invades a homologous region in another incomplete molecule, and in concert with [[protein|RecD2]] helicase, reconstitutes a complete linear phage genome with redundant regions at the ends of the molecule [pubmed|31876108]
The protein
Protein family
recA family (according to Swiss-Prot)
RecA family (together with [[protein|RadA]]) (according to UniProt)
The protein
Effectors of protein activity
[[protein|RecO]] and [[protein|DprA]] provide [[protein|RecA]] access to ssDNA during chromosomal transformation [Pubmed|22373918]
[[protein|RecO]] and [[protein|DprA]] provide [[protein|RecA]] access to ssDNA during chromosomal transformation [Pubmed|22373918]
interaction with [[protein|DisA]] inhibits [[protein|RecA]] filament growth and [[protein|RecA]]-mediated DNA strand exchange [pubmed|30916351]
The protein
Structure
[PDB|1U94] (RecA from ''E. coli'', 62% identity, 86% similarity)
[PDB|1UBC] (RecA from ''Mycobacterium smegmatis'', 67% identity) [pubmed|12837805]
Biological materials
Mutant
IRN444 (cat), available in [SW|Jörg Stülke]'s lab
1A746 (''recA''::''erm''), [Pubmed|1391055], available at the [http://bgsc.org/getdetail.php?bgscid=1A746 Bacillus Genetic Stock Center]
1A786 (''recA''::''kan''), [Pubmed|11208805], available at the [http://bgsc.org/getdetail.php?bgscid=1A786 Bacillus Genetic Stock Center]
BP469 (''recA''::''erm''), available in [SW|Fabian Commichau]'s lab
BKE16940 (''[[gene|recA]]''::''erm'', available in the [http://bgsc.org/ Bacillus Genetic Stock Center], in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs)
IRN444 (cat), available in [SW|Jörg Stülke]'s lab
GP2542(Δ[[gene|recA]]::spc trpC2), available in [SW|Jörg Stülke]'s lab
1A746 (Δ''recA''::''erm''), [Pubmed|1391055], available at the [http://bgsc.org/getdetail.php?bgscid=1A746 Bacillus Genetic Stock Center]
1A786 (Δ''recA''::''kan''), [Pubmed|11208805], available at the [http://bgsc.org/getdetail.php?bgscid=1A786 Bacillus Genetic Stock Center]
BP469 (Δ''recA''::''erm''), available in [SW|Fabian Commichau]'s lab
BKE16940 (''[[gene|recA]]''::''erm'', available in the [http://bgsc.org/ Bacillus Genetic Stock Center], in [SW|Fabian Commichau]'s, and in [SW|Jörg Stülke]'s labs) [pubmed|28189581]
BKE16940 ([[gene|recA]]::erm [[gene|trpC2]]) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
BKK16940 ([[gene|recA]]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK16940 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTATTTTTTCCTCCTT, downstream forward: _UP4_TAAAAATAAAATAAGTTTCA
Biological materials
Expression vector
for expression, purification in ''E. coli'' with N-terminal His-tag, pRSETA available in [SW|Ulf Gerth]'s lab
Labs working on this gene/protein
[SW|Peter Graumann], Freiburg University, Germany [http://www.biologie.uni-freiburg.de/data/bio2/graumann/index.htm homepage]
References
Reviews
References
Original publications
The protein
Paralogous protein(s)
[[this]]
Biological materials
Expression vectors
for expression, purification in ''E. coli'' with N-terminal His-tag, pRSETA available in [SW|Ulf Gerth]'s lab
labs
[SW|Peter Graumann], Freiburg University, Germany [http://www.biologie.uni-freiburg.de/data/bio2/graumann/index.htm homepage]